circad | circRNAs associated with diseases

hsa_circ_101555/hsa_circ_0001955
Gene	CSNK1G1	Organism	Human
Genome Locus	chr15:64495280-64508912:-	Build	hg19
Disease	Cutaneous Squamous Cell Carcinoma	ICD-10	Cervix uteri, unspecified (C53.9)
DBLink	Link to database	PMID	27298156
Experimental Method
Sample Type	Skin Tissues	Comparison	six cSCC and six non-lesional skin (control) biopsies were harvested. Microarray based circRNA expression was determined in the cSCC (n=3) and compared with the non-lesional skin (n=3
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAGAAAGCCACACACATAGGG Reverse CGGTCACAGAGGTCAAACAAG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Sand, M, Bechara, FG, Gambichler, T, Sand, D, Bromba, M, Hahn, SA, Stockfleth, E, Hessam, S (2016). Circular RNA expression in cutaneous squamous cell carcinoma. J. Dermatol. Sci., 83, 3:210-8.